ORF

Wikipedia(e)tik
Hona jo: nabigazioa, Bilatu
Irakurtarau baten eskema,hasiera kodona (start) eta bukaera kodona (stop) adierazten direlarik.

Genetika molekularrean, irakurtarau ireki edo ORF bat (Open reading frame ingelesez) hasierako kodoi baten (AUG) eta bukaera kodoi baten arteko DNA sekuentzia bat da, introiei dagokien sekuentziak kontuan hartu gabe. UTRen artean agertzen dira, hau da, itzultzen ez diren sekuentziak.

DNA sekuentzia batean, printzipioz, sei zentzu posibletan ager daitezke irakurtarauak; kodoi bakoitzak hiru nukleotido hartzen dituenez, hiru hasiera leku dago kodoiak hirunaka hartzeko, laugarren nukleotido bat hasiera gisa hartuz gero, lehenbiziko irakurtarauarekin kointzidituko zuelarik. Hiru irakurtarau hauei beste hiru gehitu behar zaizkio aurkako zentzuan, itzulpena DNAren harizpi osagarria molde gisa hartuta gertatzen bada.

Sei irakurtarau hauek +1, +2, +3, -1, -2 eta -3 izena hartzen dute

5' aactgcagtacgtaacgtca 3' sekuentzia adibide gisa hartuta, hauek dira irakurtarauak:


+3 5'   a act gca gta cgt aac gtc a 3'
+2 5'  aa ctg cag tac gta acg tca   3'
+1 5' aac tgc agt acg taa cgt ca    3'
-1 3' ttg acg tca tgc att gca gt    5'
-2 3'  tt gac gtc atg cat tgc agt   5'
-3 3'   t tga cgt cat gca ttg cag t 5'

Irakurtarau bakoitzak sekuentzia proteiko zeharo ezberdina emango du.

Ikus, gainera[aldatu | aldatu iturburu kodea]

Kanpoko loturak[aldatu | aldatu iturburu kodea]