ORF

Wikipedia, Entziklopedia askea
Jump to navigation Jump to search
Irakurtarau baten eskema,hasiera kodona (start) eta bukaera kodona (stop) adierazten direlarik.

Genetika molekularrean, irakurtarau ireki edo ORF bat (Open reading frame ingelesez) hasierako kodoi baten (AUG) eta bukaera kodoi baten arteko DNA sekuentzia bat da, introiei dagokien sekuentziak kontuan hartu gabe. UTRen artean agertzen dira, hau da, itzultzen ez diren sekuentziak.

DNA sekuentzia batean, printzipioz, sei zentzu posibletan ager daitezke irakurtarauak; kodoi bakoitzak hiru nukleotido hartzen dituenez, hiru hasiera leku dago kodoiak hirunaka hartzeko, laugarren nukleotido bat hasiera gisa hartuz gero, lehenbiziko irakurtarauarekin kointzidituko zuelarik. Hiru irakurtarau hauei beste hiru gehitu behar zaizkio aurkako zentzuan, itzulpena DNAren harizpi osagarria molde gisa hartuta gertatzen bada.

Sei irakurtarau hauek +1, +2, +3, -1, -2 eta -3 izena hartzen dute

5' aactgcagtacgtaacgtca 3' sekuentzia adibide gisa hartuta, hauek dira irakurtarauak:

+3 5'  aa ctg cag tac gta acg tca   3'
+2 5'   a act gca gta cgt aac gtc a 3'
+1 5' aac tgc agt acg taa cgt ca    3'
-1 3' ttg acg tca tgc att gca gt    5'
-2 3'   t tga cgt cat gca ttg cag t 5'
-3 3'  tt gac gtc atg cat tgc agt   5'

Irakurtarau bakoitzak sekuentzia proteiko zeharo ezberdina emango du.

Ikus, gainera[aldatu | aldatu iturburu kodea]

Kanpo estekak[aldatu | aldatu iturburu kodea]